Patients
Eighty subjects from the First Affiliated Hospital of Kunming Medical University (Kunming, China), between April 2015 and December 2017, were selected for the present study. All subjects collected from 30 to 65 years old individuals. Of these subjects, 40 were RHD patients, 20 were congenital valvular heart disease patients, and the remaining 20 were normal healthy adults with no medical history of congenital heart disease, cardiomyopathy, liver or renal diseases. The inclusion criteria, as described in [4], for the RHD group are as follows: (i) every patient diagnosed with mitral valve prolapse because of mitral chordae tendineae fracture and mitral insufficiency and scheduled for mitral valve replacement; (ii) left ventricular ejection fraction (EF) > 50%; and (iii) left ventricular end-diastolic diameter (LVEDD) < 55 mm. All human materials were obtained in accordance with the hospital’s regulations and hence were approved by the Ethics Committee of Kunming Medical University. Written informed consent was also obtained from all the subjects in advance.
Tissue and serum collection
Human heart valve tissue samples were obtained from the patients who received mitral valve replacement surgery in the First Affiliated Hospital of Kunming Medical University. The tissues and serum were stored in liquid nitrogen until use.
MiRNA sequencing
Total RNA, including miRNA, was extracted using Trizol Reagent (Invitrogen, Carlsbad, CA, USA) from serum and passed the RNA quality control for sequencing [5]. The quality and integrity of the total RNA were assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies, USA). High-throughput next-generation sequencing was carried out to achieve optimal serum miRNA profiles. We carried out miRNA sequencing (Illumina, BGI, Shenzhen) following the manufacturer’s instructions. We screened the high quality clean read sequences by alignment to NCBI GenBank data and miRBase 21.0 for further analysis. We calculated the fold change (FC) and P-value via the t-test and corrected the P-value in the false discovery rate (FDR) using the Benjamini and Hochberg method. FDR ≤ 0.05 and | log2FC ≥ 2 were set as the cut-offs to screen out the differentially expressed miRNAs. The coordinately regulated miRNAs were selected for further investigation as described in the Results.
Quantitative reverse transcription–PCR analysis of miRNA expression levels
Quantitative reverse transcription-PCR was used to validate the sequencing results [6]. Total RNA from serum, including miRNA, was extracted using Trizol Reagent (Invitrogen, CA). Reverse transcription of the total RNA was performed using an All-in-One First-Strand cDNA Synthesis kit (GeneCopoeia Inc., USA) according to the manufacturer’s protocol. Real-time PCR was performed by using All-in-OneTM qPCR Mix (Applied GeneCopoeia Inc., USA) on a Roche Lightcycler 480 System. U6 snRNA was used as the miRNA endogenous control. All samples were normalized to the internal control, and fold changes were calculated through relative quantification.
Bioinformatics analysis
Four software programs (miRWalk, miRanda, RNA22 and Targetscan) were used for target gene prediction, and only the genes identified by all four approaches were selected [7]. To understand the possible functions of the predicted target genes, Gene Ontology (GO) [8] and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed with the GO stats package (http://www.geneontology.org/), with a P value < 0.05 set as the cut-off to select significantly enriched terms.
Luciferase reporter assay
The 3’UTR of IL1β was synthesized starting with the sequence “GAGCCTAGTT TTTAAT” to the end of the mRNA and cloned into the pmiRGLO vector [9]. HEK293 cells were cultured on a 12-well plate and transfected with 100 ng of the reporter plasmid, hsa-miR-205-3p mimic (200 nM in each well) or both. Firefly and Renilla activities were determined 24 h after transfection using Beetlejuice and Renilla juice reagents (Beyotime, China). The influences of hsa-miR-3909 on the IL1R1 3’UTR were tested in the same way. The 3’UTR of IL1R1 was cloned using the following primers: forward, 5′ CGATTGCAGGACACAAGCAC 3′ and reverse, 5′ AAGCAGGTGGAAAGGCAAGA 3′.
Immunohistochemistry
Mitral valve tissues were fixed in 4% PFA for 24 h. After fixation, the tissue was dehydrated to enable embedding in paraffin, which is water insoluble. The tissue was dehydrated gently by immersion in increasing concentrations of alcohol. The alcohol was then cleared by incubation in xylene prior to paraffin embedding. The paraffin was typically heated to 60 °C and allowed to harden overnight. Finally, the tissue was sectioned into 8-μm-thick paraffin sections using a microtome. Sections were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked by incubation for 30 min in 3% H2O2 in methanol at room temperature. Antigen retrieval was performed using microwave treatment for 15 min in citrate buffer (pH 6.0). The sections were blocked with 10% goat serum at 37 °C for 1 h and incubated with rabbit polyclonal antibody against human IL-1β or rabbit monoclonal antibody against human IL1RA (both applied at 1:200, Abcam, USA) in a humidified chamber overnight at 4 °C. Next, the sections were incubated with HRP conjugated secondary antibody for 1 h at room temperature, developed with DAB chromogen for 10 min at room temperature, rinsed in running tap water for 5 min, and counterstained with haematoxylin-eosin staining. The antibodies used in the present study are as follows: anti-IL1β antibody (ab2105, Abcam, USA) and anti-IL1R1 antibody (ab106278, Abcam, USA).
Immunoblotting
Mitral valve tissues samples were lysed with RIPA Lysis Buffer (Beyotime, China) containing PMSF protease inhibitor (Beyotime, China). Tissue lysates were cleared by centrifugation at 12,000×g for 10 min. Tissue lysates (20–30 μg protein) were separated on a 10% SDS–polyacrylamide gel and transferred onto PVDF membranes. The membrane was blocked in Tris-buffered saline (20 mM Tris, 150 mM NaCl, pH 7.4) containing 5% BSA and 0.1% Tween-20 for 2 h and then incubated with primary antibodies (1:1000 dilution) overnight. After blocking, washing, and incubation with appropriate secondary antibody, blots were developed using Super Signal chemiluminescence reagents (Pierce, Rockford, IL, USA). The bands of interest from the immunoblots were scanned by densitometry, and the integrated density of the pixels in the identified areas was quantified using ImageJ (NIH, Bethesda, MD). The antibodies used in the present study were as follows: anti-IL1 beta antibody (ab2105, Abcam, USA), anti-IL1R1 antibody (ab106278, Abcam, USA), β-Actin (8H10D10) mouse mAb antibody (#3700, Cell Signaling Technology, USA), goat anti-mouse IgG-HRP antibody (sc-2005, Santa Cruz Technology, USA) and goat anti-rabbit IgG-HRP (sc-2004, Santa Cruz, USA).
