Increased expression of NF-AT3 and NF-AT4 in the atria correlates with procollagen I carboxyl terminal peptide and TGF-β1 levels in serum of patients with atrial fibrillation

Patients

We recruited 90 VHD patients, comprising pathological changes in the mitral or aortic valves, or both, admitted to the First Affiliated Hospital of Nanjing Medical University for valve replacement surgery from January 2012 to January 2013. The patients were divided into three groups: sinus rhythm (SR; n = 30), persistent AF (PeAF; AF lasting >6 month, n = 30), and paroxysmal AF (PaAF; recurrent AF that terminated spontaneously in <7 days, n = 30). The control group (n = 10) comprised patients with congenital heart disease and SR who underwent heart surgery. We excluded four categories of patients from this study: (i) patients with renal dysfunction (serum creatinine >136 μmol/L) or Type II diabetes, (ii) patients whose coronary angiography and echocardiographic evaluation indicated coronary artery bypass grafting or associated procedures, (iii) patients >70 years, or those with a history of some diseases (e.g., hyperthyroidism) that influence AF risk, and (iv) patients with fibrosis disease that could affect serum fibrosis biomarkers. Preoperative medications, except warfarin and angiotensin-converting enzyme inhibitors, were continued until the morning of the surgery. Prior to surgery, an investigator assessed the preoperative clinical characteristics of the patients. Before discharge, another investigator recorded detailed operative data. The Ethics Committee of Nanjing Medical University approved the study protocol, and all patients provided written consent prior to enrollment. The investigation adhered to the principles outlined in the Declaration of Helsinki.

Human cardiac tissue collection and storage

The same cardiac anesthesiologist, perfusionist, and surgical team performed all surgeries. All patients underwent cardiopulmonary bypass with moderate hypothermia (33–34°C). Antegrade crystalloid cardioplegia was used to arrest the heart, and local hypothermia was maintained with ice slush. A cardioplegic solution was readministered every 20–30 min. Approximately 250 mg of right atrial appendage (RAA) tissue was collected from the cannulation site, and approximately 250 mg of left atrial appendage (LAA) tissue was collected in the PeAF and PaAF group before initiating extracorporeal circulation. In our department, LAA ligation and resection is a routine surgical maneuver in rheumatic valvular disease patients with AF. To minimize damage, we only collected LAA samples from the AF group; this surgical maneuver was not necessary in the SR group. The sample site was similar because of similar surgical maneuvers. A 50 mg portion of RAA and LAA tissue was fixed in 4% paraformaldehyde for histology and immunohistochemistry. The remaining tissue was snap-frozen in liquid nitrogen for other analyses.

Reverse transcription-polymerase chain reaction (RT-PCR)

Total RNA was isolated from the atrial tissue samples and treated with RNase-free water according to the TRIzol® (Invitrogen, Carlsbad, CA, USA) method. Single-stranded cDNA was synthesized from the total RNA as follows. In brief, 2 μg RNA was preincubated with 1.5 μL oligo (dT)₁₈ primer (10 μmol/L; Genscript Technology Co., Nanjing, China), and diethylpyrocarbonate (DEPC)-treated water (0.1% DEPC; Keygen, China) in a total volume of 10 μL. This solution was incubated at 70°C for 10 min and then rapidly chilled on ice. The reaction was initiated by incubation at 42°C for 1 h in a Multigene™ Gradient TC9600-G-230 V thermal cycler (Labnet International Inc., Edison, NJ, USA) and was deactivated at 70°C for 15 min, followed by immersion in ice. The resultant cDNA was used as a template for subsequent PCR. Thirty cycles of PCR amplification were performed, with initial incubation at 94°C for 5 min and final extension at 72°C for 5 min. Each cycle comprised denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s. The collagen I, collagen III, NF-AT3, and NF-AT4 genes were amplified using the following specific primers: collagenI (sense: 5′- TTCCTGCGCCTGATGTCC -3′, antisense: 5′- GGTTCAGTTTGGGTTGCTTGT -3′); collagenIII (sense: 5′- TCAACACCGATGAGATTATGAC -3′, antisense: 5′- CAAAGGATTGGCACTTATGC -3′); NF-AT3 (sense: 5′- GGGACAACAGAACCAGAGTAAC -3′, antisense: 5′- AAACAGAATAGTCCACCTTGAGA -3′); NF-AT4 (sense: 5′- TTGGAACACCAGCCATCAGG -3′, antisense: 5′- GCTGCTCCTGTTCTTTTGCC -3′). The quantities of cDNA that produced an equal amount of GAPDH PCR product were used for PCR using the primers for collagenI, collagenIII, NF-AT3, and NF-AT4. PCR product levels were semiquantitatively determined using a digital camera and an image analysis system (Gel Doc™ XR; Bio-Rad, Hercules, CA, USA), followed by normalization against GAPDH expression.

Western blotting

In preparation of whole tissue extracts, atrial tissue samples were homogenized on ice in RIPA lysis buffer (Thermo Fisher Scientific Inc, Rockford, IL USA). Lysates were incubated on ice for 10 min at 4°C and subsequently centrifuged at 9300 × g for 10 min. Supernatants were saved and stored at -70°C. Nuclear extracts were prepared as follows [17]. Approximately 250 mg of atrial tissue was washed with cold PBS, homogenized, and resuspended in 1 ml of hypotonic buffer. Homogenates were incubated for 10 min on ice and centrifuged (10 min, 800 × g at 4°C). Pellets were resuspended in 0.15 ml of hypertonic buffer and incubated on ice for 20 min. Samples were centrifuged (10 min, 13 000 × g at 4°C), and supernatants (nuclear protein extract) were stored in aliquots at -80°C. Protein concentrations were determined using the Lowry method, and absorbance was measured spectrophotometrically (UV 2540; Shimadzu, Kyoto, Japan). Denatured samples were subjected to western blotting as follows. Samples containing 25 μg of protein were electrophoretically separated on a 10% SDS-polyacrylamide gel for 1.5 h at 120 V, and the proteins were transferred to nitrocellulose membranes (Pall Corporation, Ann Arbor, MI, USA). After blocking in 5% fat-free milk, the membranes were incubated overnight at 4°C with primary antibodies (dilution) against collagen I (1:200, Biosynthesis Biotechnology Company, Inc., Beijing, China), collagen III (1:200, Bioss), NF-AT3 [1:1000; Cell Signaling Technology Inc., USA), and NF-AT4 (1:1000; Cell Signaling Technology). Anti-GAPDH (1:1000; Cell Signaling Technology Inc.) and anti-lamin B (1:1000; Cell Signaling Technology Inc.) polyclonal antibodies were used as controls to normalize the data. The membranes were then incubated for 2 h at 37°C with secondary antibodies (goat anti-rabbit IgG diluted in PBS containing 5% fat-free milk and 0.1% Tween-20). The stained membranes were visualized using enhanced chemiluminescence with the ECL Plus reagent (GE Healthcare, Chalfont St. Giles, Buckinghamshire, UK). Western blotting was repeated at least thrice per sample with similar results.

Blood sampling and enzyme-linked-immunosorbent serologic assay (ELISA)

Venous blood samples were obtained in EDTA from every patient before surgery. Serum was separated by centrifugation (1800 × g, 5 min, room temperature), and stored at -80°C until analysis. Serum PIIINP, PINP, TGF-β1, and PICP levels were determined by sensitive ELISA kits (Senxiong Biotechnology Industry Inc., Shanghai, China), according to the manufacturer’s instructions. Assays were performed in duplicate in a single run and normalized to a standard curve.

Histology and immunohistochemistry

RAA and LAA samples were fixed with 4% paraformaldehyde in phosphate-buffered saline (pH 7.4) for 24 h. After alcohol dehydration, the tissues were embedded in paraffin and sectioned. The 2-μm-thick serial sections were then stained with Van Gieson’s solution for microscopic examination. For NF-AT3 and NF-AT4 (Biosis) detection, immunoreactivity was performed on 4-μm-thick sections of the paraffin-embedded tissues. Brown staining in the cells or cell membranes was considered positive. Hypertrophic heart ventricle tissues were selected as a positive control, and negative controls were sections incubated with antibodies pre-absorbed with the NF-AT3 and NF-AT4 peptide (Abcam). The entire sections were scanned at low magnification (×100) initially to select regions, and then high magnification (×400) was used for focused investigation.

Statistical analyses

Values are expressed as the mean ± standard deviation. Differences among three or more groups were analyzed using the Kruskal–Wallis test. Differences between any two groups were analyzed using the Mann–Whitney U test. Chi-square and Fisher’s exact tests were used to determine the differences between the groups. Univariate regression tests were used to assess the associations among the expression of NF-AT3 and NF-AT4 in the nucleus, collagens I and III in atrial tissue, and PINP, PIIINP, PICP, and TGF-β1 in the blood. Differences yielding p <0.05 were considered significant. Data were analyzed using GraphPad Prism version 5.01 and STATA version 10.0.530.0.

Clinical characteristics and hemodynamic data

Serum PINP, PIIINP, PICP, and TGF-β1 levels were increased in the AF groups

Expression of collagen I, collagen III, NF-AT3, and NF-AT4 mRNA and protein were increased in the AF groups

Immunohistochemistry showed that total NF-AT3 (Figure 1) and NF-AT4 (Figure 2) expression were upregulated in the AF groups compared with the SR and control groups. We also demonstrated that collagen I, collagen III, total NF-AT3, and NF-AT4 expression were upregulated in the AF groups using RT-PCR and western blotting (Figure 3A,B; Figure 4A,B). We also demonstrated that nuclear NF-AT3 and NFAT4 expression was upregulated in the AF group compared with the SR group (Figure 5A,B).

Analysis of the expression of NF-AT3 and NF-AT4 and collagens I and III in the right and left atria of patients with AF

In the left atrium of patients with AF, collagen I mRNA expression was not correlated with NF-AT3 and NF-AT4 mRNA expression. Collagen I protein expression was positively correlated with nuclear NF-AT3 expression (p <0.01), but not with nuclear NF-AT4 expression. Levels of collagen III mRNA expression were positively correlated with NF-AT4 mRNA expression (p < 0.01), but not with NF-AT3 expression. Collagen III protein expression was positively correlated with nuclear NF-AT3 (p <0.01) and nuclear NF-AT4 expression (p <0.01).

Correlation between collagen I and collagen III levels in the right and left atria with PIIINP, PINP, TGF-β1, and PICP levels in the blood of patients with AF

Correlation between nuclear NF-AT 3 and NF-AT 4 levels in the right and left atria and PIIINP, PINP, TGF-β1, and PICP levels in the blood of patients with AF

Analysis of NF-AT3 and NF-AT4 protein expression in the right atria of patients with different valvular disease