Skip to main content

Table 1 Description of 4 SNPs and the assays or primers designed for genotyping

From: Analysis for interaction between interleukin-35 genes polymorphisms and risk factors on susceptibility to coronary heart disease in the Chinese Han population

SNPs Chromosome Functional Consequence Major/minor alleles Genotyping assays or primers
EBI3 19:4229916 Intron variant G > C GAATTTGAGTCACACTCATTCCTTT[C/G]
rs428253 GTTTCTTTTTGGTTTTGTTTTTTGA
EBI3 19:4236999 Missense variant, coding sequence variant G > A TGTGCGGCCCCGAGCCAGGTACTAC[A/G]
rs4740 TCCAAGTGGCGGCTCAGGACCTCAC
IL-12A rs2243115 3:159988493 Upstream transcript variant, intron variant T > G Forward: 5′-AGAAAAGACCTGTGAACAAAACGACT-3′
Reverse: 5′-AGATGGCTCACTAGATGCCAGG-3′
IL-12A rs568408 3:159995680 3 prime UTR variant, intron variant G > A Forward: 5′-GAAGGATGGGACYATTACATCCATAT-3′
Reverse: 5′-CAGGATGGATATTTTCCCTTCT-3′