Skip to main content

Table 1 Sequences of oligonucleotide probes used for polymorphism detection

From: The association of functional polymorphisms in genes encoding growth factors for endothelial cells and smooth muscle cells with the severity of coronary artery disease

Gene Polymorphism Nucleotide base Context sequence
FGF2 rs308395 C/G CTCTTCTATGGCCTACTTTCTACTG[C/G]
TATTTGTGTTACTCATGCTACCCAT
IGF1 rs35767 A/G GAATTTTTTCTTTTTTTTTTTTTCC[A/G] CATGACTCTCAGGGGACTGACACAT
PDGFB rs2285094 T/C CAACCAATAGAGGGGCCAATAGAAC[T/C]
GCCCAGCTGAGCCCAGTCAACCCCC
TGFB1 rs1800470 A/G TAGCCACAGCAGCGGTAGCAGCAGC[A/G]
GCAGCAGCCGCAGCCCGGAGGGCGG
VEGFA rs699947 A/C GCCAGCTGTAGGCCAGACCCTGGCA[A/C]
GATCTGGGTGGATAATCAGACTGAC