Skip to main content

Table 1 The primers of cDNA of ion channels related genes and GAPDH/Gapdh for RT-PCR analysis

From: Regulation of SCN3B/scn3b by Interleukin 2 (IL-2): IL-2 modulates SCN3B/scn3b transcript expression and increases sodium current in myocardial cells

Gene F R
SCN3B(human) attgtttcccctggcttctc gcctccacctcctctctctt
Scn3b(mouse) catcctcctggtcttcctcac cgggtaccacagagttctcct
P53(human) ccccagccaaagaagaaacc gcctgggcatccttgagttc
CACNA1C ggctgctgaggattttcaag acacagtgaggagggactgg
KCNE3 tccagagacatcctgaagagg ggtctccgttccattggtag
KCND3 tgatgttttatgccgagaagg ccatggtgactccagctctt
KCNN1 agccaccctctctcccagtca aggggttgggctcgctgca
SCN2A atgatgaaaatggcccaaag ggtggcactgaatcgagaga
SCN3A atgctgggctttgttatgct ttgctcctttcccagtaagc
SCN4A tccagcagggttggaatatc tgccaatgatcttgatgagc
SCN5A ccagatctctatggcaatcca gaatcttcacagccgctctc
SCN9A gatgatgaagaagccccaaa gtggcattgaaacggaagat
SCN10A acttgaaagcctgcaaccag cactaaaccgggaaatggtc
SCN1B tctaccgcctgctcttcttc ggcagcgatcttcttgtagc
SCN2B atccatctgcaggtcctcat catctgtgctcagcttctgc
KCNQ1 ggccacggggactctcttc tccgtcccgaagaacacca
KCNA5 ggccgaccccttcttcatc gcagctcgaaggtgaaccag
KCNH2 gaggagcgcaaagtggaaatc gccccatcctcgttcttcac
KCNJ5 ttctgaagggagcaggtcat cctagaatcgccagccatag
KCNE2 cttgtgtgcaacccagaaga gtcttccagcgtctgtgtga
Gapdh(mouse) tggccttccgtgttcctacc ggtcctcagtgtagcccaagatg
GAPDH(human) aaggtgaaggtcggagtcaac ggggtcattgatggcaacaata