Skip to main content
Download PDF

The interaction between neutrophils and atrial myocytes in the occurrence and development of atrial fibrillation

BMC Cardiovascular Disorders volume 24, Article number: 519 (2024) Cite this article

Abstract

Background

Atrial fibrillation (AF) is one of the most prevalent sustained cardiac arrhythmias, strongly associated with neutrophils. However, the underlying mechanism remain unclear. This study aims to explore the interaction between neutrophils and atrial myocytes in the pathogenesis of AF.

Methods

Patch-clamp was employed to record the action potential duration (APD) and ion channels in HL-1 cells. Flow cytometry was used to assess the differentiation of neutrophils. The mRNA and protein levels of CACNA1C, CACNA2D, and CACNB2 in HL-1 cells were detected.

Results

High-frequency electrical stimulation resulted in a shortening of the APD in HL-1 cells. Flow cytometry demonstrated that neutrophils were polarized into N1 phenotype when cultured with stimulated HL-1 cells medium. Compared to control neutrophils conditioned medium (CM), cocultured with TNF-α knockout neutrophils CM prolonged APD and the L-type Ca (2+) channel (LTCC) of HL-1 cells. Additionally, the expression of CACNA2D, CACNB2 and CACNA1C in HL-1 cells were upregulated. Compared with CACNA1C siRNA-transfected HL-1 cells treated with TNF-α siRNA-transfected neutrophils CM, the APD and LTCC of CACNA1C siRNA-transfected HL-1 cells were shortened in control N1 neutrophil CM. The APD and LTCC of control HL-1 cells were also shortened in control N1 neutrophil CM, but prolonged in TNF-α siRNA-transfected neutrophils CM.

Conclusion

These findings suggest that neutrophils were polarized into N1 phenotype in AF, TNF-α released from N1 neutrophils contributes to the pathogenesis of AF, via decreasing the APD and LTCC in atrial myocytes through down-regulation of CACNA1C expression.

Peer Review reports

Introduction

Atrial fibrillation (AF) is the most common cardiac arrhythmia affecting approximately 33.5 million patients worldwide [1, 2]. Apart from bad effect on a patient’s quality of life, it is also associated with an heightened risk of death, stroke, and peripheral embolism [3], leading to increased morbidity and mortality [4]. The prevalence of AF has been increasing for the past few years and is becoming an urgent public health concern [5, 6]. Despite its growing prevalence, the development of AF is complex and effective therapies remain limited [7, 8]. Therefore, it is necessary to further understand the underlying mechanisms and pathology of AF.

Recent studies have revealed that AF is frequently associated with enhanced inflammatory response [9]. Neutrophils, also known as polymorphonuclear leukocytes (PMN), not only functioning in innate immune responses to protect the host, but their elevated activation is also implicated in various cardiovascular diseases [10]. Immune infiltration analysis using CIBERSORT has shown increased neutrophil levels in persistent AF [11]. Infiltration of neutrophil has been observed in atrial tissue of AF patients. Furthermore, it has been reported that leukocyte activation predisposes to AF and neutrophils induced AF by CD11b/CD18 integrins [12]. In addition, it is also suggested that neutrophil to lymphocyte is described as reliable predictor of new-onset AF [13]. However, the precise role neutrophils play in the pathogenesis of AF and the underlying mechanisms remain unknown.

Neutrophils can generate an array of mediators of inflammation: Tumor necrosis factor (TNF)-α, CXCL8 (IL-8), and macrophage inflammatory proteins (MIPs) [14]. Among these factors, TNF-α is an endogenous mediator of inflammation, playing a critical role in a variety of cellular processes during inflammatory responses. Its expression is upregulated in patients with AF [15] and was positively correlate with the progression of AF, which has a predictive effect in occurrence and persistence of AF [9, 16]. While previous studies have focused mainly on the impact of TNF-α in structural remodeling of AF [17]. Its role in electrical remodeling of AF remains unclear.

In the present study, we investigated the functional interaction between neutrophils and atrial myocytes in AF. We first characterized the phenotype of neutrophils in AF. We then explored whether and how TNF-α released by N1 neutrophils effects the action potential duration and LTCC of atrial myocytes, as well as the underlying mechanism.

Materials and methods

Reagents

Mouse peripheral blood neutrophil complete medium (CM-M150), Dulbecco’s modified Eagle medium DMEM (PM150210), Fetal bovine serum FBS (164210), 0.25% trypsin and Penicillin-streptomycin solution were provided by Procell Life Science & Technology Co., Ltd (Wuhan, China). FITC anti-mouse/human CD11b Antibody, PE anti-mouse Ly-6 C Antibody and PerCP anti-mouse Ly-6G Antibody were purchased from BioLegend, Inc (USA). 30% polyacrylamide, Tris-base, ammonium persulfate, SDS, Tween-20, and marker were purchased from Solarbio Science & Technology Co., Ltd (Beijing, China). PVDF membrane were from Millipore (USA). BCA Protein Assay Kit was from Beyotime (Shanghai, China). Primary Antibody: rabbit monoclonal CACNA2D (ab253190), rabbit monoclonal CACNB2 (ab253193), rabbit monoclonal CACNA1C (ab283581), rabbit polyclonal β-actin (ab8227) and goat anti-rabbit HRP secondary antibody (ab6721) were purchased from Abcam (USA). TRIzol reagent, PrimeScript™ RT reagent Kit with gDNA Eraser, and SYBR® Premix Ex Taq were from Takara (Japan). The primers and siRNA were synthesized by Hunan Fenghui Biotechnology Co. LTD (Hunan, China). Lipofectamine 2000 were provided by Invitrogen (USA).

Cell culture

HL-1 cells were purchased from Hunan Fenghui Biological Co. LTD. Cell model of AF was established by electrical stimulation of HL-1 cells. When HL-1 cell density reached 90%, the medium was removed and washed with PBS. Serum-free medium was added to each well and incubated in a cell incubator at 37 °C for 24 h. When HL-1 cells were cultured for 48 h to 90% cell density, serum-free medium was added and serum starvation assay was performed. Rapidly pacing HL-1 cells for 24 h (25 Hz/ 5ms, 7 V/cm, C-Pace100TM). After 24 h, the culture medium was collected and used for the culture of neutrophils [18].

The murine neutrophils cell line was purchased from Procell Life Science & Technology Co., Ltd. Polarization of neutrophils toward an N1-like phenotype was conducted in 6-well plates (5 × 105/mL). Cells were incubated for 48 h at 37 °C in medium supplemented with 100 ng/mL lipopolysaccharide (LPS), 50 ng/mL IFN-γ, and 10,000 U/mL IFN-β [19].

HL-1 cells were co-cultured with conditioned neutrophils medium, in brief, neutrophils were treated with TNF-α siRNA or control siRNA, and then the medium was collected for culturing HL-1 cells. After culturing, HL-1 cells were collected for Patch-clamp recording, qPCR and Western blot assay.

Patch-clamp recording

The bath solution contained 120 mM KCl, 2 mM MgCl2, 1 mM CaCl2, 11 mM EGTA, 10 mM HEPES, and 11 mM glucose were dissolved in 10 mL of distilled water, and the PH was all adjusted to 7.4 with 100mM Tris-HCl. The internal solution contained 120 mM KCl, 2 mM MgCl2, 1 mM CaCl2, 11 mM EGTA, 10 mM HEPES, and 11 mM glucose were dissolved in 10 mL of distilled water, and the PH was all adjusted to 7.4 with 100mM Tris-HCl. Adjust the parameters of glass microelectrode puller (P-1000, Sutter Instrument Co) to achieve a water inlet resistance value of 7.0–11.0 for BF150-86-10 hollow silicon glass tube. Take out the glass slide with cells, place it in the plexiglass sample tank on the inverted microscope stage, and perfuse the cells with perfusate (extracellular fluid). Under the microscope, cells with relatively stretched surfaces were selected for electrophysiology experiments. Micro operation 10X under the mirror clamp, using a three-stage artificial negative pressure suction film, making the sealing impedance reach 1.0-2.0G Ω or above. Provide C-fast compensation. High negative pressure aspiration, forming a whole cell recording mode, and providing C-slow compensation. Maintain Rm above 600 M Ω and Ra around 30 M Ω. Convert to voltage clamp and record K current protocol (-50mv -+80mv) [20].

Flow cytometry

Neutrophils (2 × 105/mL) were seeded into a 6-well plate, and then were co-cultured with stimulated HL-1 cell medium or control HL-1 cells medium for 72 h. After washing twice with PBS, the cells were stained with fluorescein isothiocyanate (FITC)-anti-mouse/human CD11b Antibody, PE anti-mouse Ly-6 C Antibody, and PerCP anti-mouse Ly-6G Antibody. Then cells were incubated in a dark ice bath for 20 min. After incubation, cells were centrifuged at 4 ℃ for 5 minutes and resuspended in PBS. FITC, PE and PerCP were selected for detection, according to the fluorescence. The data was collected by FACSVerse flow cytometry (BD Biosciences, USA).

Small interfering (si) RNA and plasmid transfection

HL-1 cells and neutrophils were seeded at 1 × 105/mL in 12-well plates, then 1 mL of medium (without antibiotics) was added to each well and incubated for 12 h. For neutrophils transfection, TNF-α siRNA and control siRNA were diluted with 200 µL Opti-MEM and left for 5 min at room temperature. 5 µL Lipofectamine 2000 was diluted with 200 µL Opti-MEM and left for 5 min at room temperature. The diluted siRNA and Lipofectamine 2000 were mixed and left at room temperature for 25 min, then added to the cells. The cells were placed in a 37℃ 5% CO2 incubator for 30 h and the mRNA level of TNF-α was detected by qPCR after 48 h. For HL-1 cells transfection, CACNA1C siRNA and control siRNA were diluted with 200 µL Opti-MEM and left for 5 min at room temperature, and the rest of the steps are the same.

Real-time PCR

Extraction of the total RNA was performed according to the instructions of the TRIzol reagent. The RNA was then reverse transcribed into cDNA by PrimeScript™ RT reagent Kit with gDNA Eraser. Next, the SYBR® Premix Ex Taq was applied to perform real-time PCR according to the manufacturer’s instructions on the RT-PCR (ABI-7500, Applied Biosystems, USA). The primers used were as follows:

CACNA2D

forward-5’CCGCTCTTGCTCTTGCTG3’,

reverse-5’CCAGTGCTGCATCGTGTG3’;

CACNB2

forward-5’CAGCCTTGGAGTCGACTTTTT3’,

reverse-5’CTATTTTTCCTCCTGGCTCCTT3’;

CACNA1C

forward-5’GTCCAGAAGCTTCCAGA3’,

reverse-5’GATGTTCACTGAGACCAAGA3’;

GAPDH

forward-5’GTGGCCTCTGGGATGATG3’,

reverse-5’ACTCCTCAGCAACTGAGGG3’;

Western blot

Cells were lysed by using RIPA lysis buffer, the total proteins were extracted from HL-1 cells and quantified using the BCA Protein Assay Kit. Next, the protein samples were separated on the SDS-PAGE Electrophoresis System (Mini Protean 3, Bio-Rad, USA), and these proteins were transferred onto a PVDF membrane. After blocking with TBST buffer added in 5% bovine serum albumin, the PVDF membranes were incubated overnight at 4 °C with the following primary antibodies: rabbit monoclonal CACNA2D, rabbit monoclonal CACNB2, rabbit monoclonal CACNA1C, and rabbit polyclonal β-actin. The chemiluminescence was carried out by chemiluminescence immune detection system (Tanon 5200, Shanghai, China). The images were analyzed by Image J software.

Statistical analysis

The experimental data were expressed as Mean ± standard error (Mean ± SEM), and all data were processed and analyzed by GraphPad Prism 6. The t-test was used to compare the means of two groups of samples, and the ANOVA test was used to compare the means of multiple groups of samples. P < 0.05 was considered statistically significant.

Results

AF promoted neutrophils polarization of N1 phenotype

We first established Atrial fibrillation model by using HL-1 cells. The results are shown in Fig. 1A, after 24 h electrical stimulation, the APD of HL-1 cells was 307.267 ms (left), which was significantly shorter than HL-1 cells without any stimulation (right, 351.556 ms). After 24 h of stimulation and culturing, HL-1 cells CM was collected and used for culturing neutrophils. Then, neutrophils were co-cultured with stimulated HL-1 cells CM or control HL-1 cells CM for 72 h. Several typical N1 surface markers were investigated to determine the neutrophils phenotype by flow cytometry. As shown in Fig. 1B, when neutrophils co-cultured with stimulated HL-1 cells CM, the percentages of CD11b+/Ly6G+/Ly6C+ positive cells (N1 phenotype) were 68.64%. When cells co-cultured with control HL-1 cells CM, N1 phenotype accounted for 54.06%.

Fig. 1
figure 1

(A) The action potential duration (APD) of HL-1 cells was prolonged after 24 h of electrical stimulation. (B) Co-cultured with control HL-1 cells medium, the proportion of N1 neutrophil (CD11b+/Ly6G+/Ly6C+) was 54.06%, co-cultured with stimulated HL-1 cells medium, the proportion of N1 neutrophil was 68.64%

Full size image

Effect of TNF-α released from N1 neutrophils on the electrophysiology of HL-1 cells

N1 neutrophils were generated by incubation with LPS, IFN-γ, and IFN-β [19], and flow cytometry was used to detect the proportion of N1 neutrophils. The results were shown in Fig. 2A, N1 phenotype accounts for 85.35% of all cells. To investigate the electrophysiological effect of N1 neutrophils on HL-1 cells, HL-1 cells were treated with TNF-α siRNA-transfected N1 neutrophils CM. The APD and LTCC of cells were detected and shown in Fig. 2B. Compared with control N1 neutrophils CM, APD and LTCC of cells were significantly prolonged in TNF-α knockout group. Furthermore, we investigated the expression of LTCC genes, including CACNA2D, CACNB2, and CACNA1C, and the related proteins in these two groups. The mRNA expression of CACNA2D, CACNB2, and CACNA1C were increased in TNF-α knockout group when compared with control group (Fig. 2C). The expression of indicated proteins was shown in Fig. 2D, compared with control group, the expression of CACNA2D, CACNB2 and CACNA1C proteins in TNF-α knockout group were significantly upregulated, among which CACNA1C protein showed the largest increase.

Fig. 2
figure 2

(A) N1 neutrophils accounted for 85% of all cells. (B) Co-culture with TNF-α siRNA-transfected neutrophil conditioned medium significantly prolonged the APD and the LTCC of HL-1 cells. (C) Co-culture with TNF-α siRNA-transfected neutrophil conditioned medium significantly elevated the mRNA level of CACNA1C, CACNB2, and CACNA2D in HL-cells. (D) Co-culture with TNF-α siRNA-transfected neutrophil conditioned medium significantly elevated the protein level of CACNA1C, CACNB2, and CACNA2D in HL-1 cells. Data were compiled from three independent experiments. *P < 0.05, **P < 0.01, and ***P < 0.001 vs. control group

Full size image

Mechanism of electrophysiological changes in HL-1 cells induced by N1 neutrophils

When treated with TNF-α knockout N1 neutrophils CM, the CACNA1C expression showed the largest increase among these three proteins. Therefore, we transfected HL-1 cells with CACNA1C siRNA to investigate the underlying mechanism. The APD of CACNA1C siRNA-transfected HL-1 cells in the presence of TNF-α siRNA-transfected N1 neutrophils CM was 355.510 ms (Fig. 3A), which is longer than that of CACNA1C siRNA-transfected HL-1 cells in the presence of control N1 neutrophil CM (339.560 ms, Fig. 3B). The APD of control HL-1 cells in the presence of control N1 neutrophil CM was 342.021 ms (Fig. 3D). In contrast, the APD of control HL-1 cells in the presence of TNF-α siRNA-transfected neutrophils CM was 364.843 ms (Fig. 3C). The LTCC results of these four groups were showed in Fig. 3E and H. The LTCC was 958.813 pA of CACNA1C siRNA-transfected HL-1 cells in the presence of TNF-α siRNA-transfected N1 neutrophils CM (Fig. 3E), which is longer than that of CACNA1C siRNA-transfected HL-1 cells in the presence of control N1 neutrophil CM (602.862 ms, Fig. 3F). The APD of control HL-1 cells in the presence of control N1 neutrophil CM was 690.631 ms (Fig. 3H). In contrast, the APD of control HL-1 cells in the presence of TNF-α siRNA-transfected neutrophils CM was 1111.763 ms (Fig. 3G).

Fig. 3
figure 3

The APD of CACNA1C siRNA-transfected HL-1 cells treated with TNF-α siRNA-transfected N1 neutrophil CM (A); CACNA1C siRNA-transfected HL-1 cells treated with control N1 neutrophil CM (B); Control HL-1 cells treated with TNF-α siRNA-transfected N1 neutrophil CM (C); Control HL-1 cells treated with control N1 neutrophil CM (D); The L-type calcium channel currents of CACNA1C siRNA-transfected HL-1 cells treated with TNF-α siRNA-transfected N1 neutrophil CM (E); CACNA1C siRNA-transfected HL-1 cells treated with control N1 neutrophil CM (F); Control HL-1 cells treated with TNF-α siRNA-transfected N1 neutrophil CM (G); Control HL-1 cells treated with control N1 neutrophil CM (H)

Full size image

Discussion

The main findings of the present study are as follows: [1] Stimulated HL-1 cells induced N1 polarization of neutrophils [2]. The prolonged effect of N1 neutrophils on APD and LTCC of HL-1 cells was mediated by TNF-α knockout, which significantly upregulated the expression of CACNA2D, CACNB2 and CACNA1C expression in HL-1 cells [3]. Further confirmed that knockout TNF-α in N1 neutrophils induced electrophysiological changes of HL-1 cells by affecting CACNA1C expression.

AF is a common arrhythmia in clinics with a characteristic of the alteration of electrophysiology that promotes persistent AF [21, 22]. This phenomenon is often described as atrial remodeling, which is associated with downregulation of LTCC and shortening of atrial APD [23, 24]. LTCCs are a common Ca-signaling element in cardiac myocytes, which is essential for calcium influx [25] and the excitation-contraction coupling process [26]. In our study, we established a cell model of AF by stimulating HL-1 cell with electricity for 24 h. Our results showed that the APD of HL-1 cells was shortened compared with non-stimulated cells. Subsequently, we treated the neutrophils with stimulated HL-1 cells conditioned medium. Previous studies have reported the increased number of neutrophils in AF, but the phenotype and functions remained unknown. The study by He demonstrated neutrophil extracellular traps (NETs) can directly interact with cardiomyocytes, leading to alterations in electrical signaling and structural remodeling of the atrial tissue [27]. What’s more, neutrophils can undergo functional polarization, leading to selective activity patterns associated with different diseases. Two neutrophil phenotypes have been described, the pro-inflammatory (N1) and the suppressor (N2), based on their abilities to degranulate [28, 29]. We found that stimulated HL-1 cells medium triggers the polarization of N1 neutrophils. This may verify the presence of N1 neutrophils at the site of atrial. The N1 phenotypes could increase the inflammation by secreting TNF-α and IL-6. Which supported previously report that inflammation was closely related with AF [30, 31].

TNF-α is a pro-inflammatory cytokine, which enhances intracellular Ca2+ signaling [32, 33]. Relevance to this study, it has been reported that TNF-α was elevated in AF and promote it [17]. In our present study, knockout TNF-α in neutrophils prolonged APD and induced LTCC activation in HL-1 cells. TNF-α also plays a role in electrical remodeling of AF. Previously study has demonstrated that increase of LTCC prolongs the APD [34], which contributes to electrical remodeling in AF. Therefore, we speculated that neutrophils might be involved in electrical remodeling in AF. However, some studies have indicated that TNF-α had no effect on LTCC in ventricular myocytes from neonatal mice [35]. Our study further showed that TNF-α knockout upregulated the mRNA and protein levels of CACNA2D, CACNB2, and CACNA1C in HL-1 cells. These three subunit genes encoded the subunits proteins that compose LTCC, with CACNA1C expression showing the most significant increase among them. It has been reported that CACNA1C-encoded cardiac LTCC α1c subunits is essential for APD [36] and CACNA1C regulated atrial electric remodeling in AF [21]. Targeting CACNA1C could attenuate atrial fibrillation [37]. TNF-α also upregulated LTCC in primary mouse tracheal smooth muscle cells via protein kinase C-Src-CaV1.2 pathways, which indicated that this pathway may be involved in underlying mechanism of AF. We further examined CACNA1C, finding that its reduction may inhibit LTCC activation and lead to a decrease in APD. CACNA1C knockdown HL-1 cells was used. We found that the TNF-α released by neutrophil may inhibit CACNA1C expression, thereby shortening the APD and activity of LTCC in HL-1 cells. Targeting TNF-α may represent a novel therapeutic approach for treating AF and its inhibition could help mitigate the progression or onset of this condition.

Our study has several limitations. First, the interaction between neutrophils and atrial myocytes should be further investigated in mouse model of AF to validate the conclusions drawn in our vitro experiments. Second, we found that N1 neutrophil promote AF, the function of N2 neutrophil and N1/N2 ratio in AF remains unclear. Finally, the exact mechanisms of which TNF-α mediated-CACNA1C expression need to be further investigated.

Conclusion

We evaluated the roles of neutrophil infiltration in AF. Neutrophils were polarized into N1 phenotype in AF models, and knockdown of N1 neutrophils shorten the APD and activity of LTCC in HL-1 cells through inhibiting CACNA1C expression.

Data availability

The data involved in the present study can be provided under reasonable request.

References

  1. Brundel B, Ai X, Hills MT, Kuipers MF, Lip GYH, de Groot NMS. Atrial fibrillation. Nat Rev Dis Primers. 2022;8(1):21.

    Article  PubMed  Google Scholar 

  2. Hindricks G, Potpara T, Dagres N, Arbelo E, Bax JJ, Blomstrom-Lundqvist C, et al. 2020 ESC guidelines for the diagnosis and management of atrial fibrillation developed in collaboration with the European Association for Cardio-Thoracic Surgery (EACTS): the Task Force for the diagnosis and management of atrial fibrillation of the European Society of Cardiology (ESC) developed with the special contribution of the European Heart Rhythm Association (EHRA) of the ESC. Eur Heart J. 2021;42(5):373–498.

    Article  PubMed  Google Scholar 

  3. Virani SS, Alonso A, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP, et al. Heart Disease and Stroke Statistics-2020 update: a Report from the American Heart Association. Circulation. 2020;141(9):e139–596.

    Article  PubMed  Google Scholar 

  4. Andersen JH, Andreasen L, Olesen MS. Atrial fibrillation-a complex polygenetic disease. Eur J Hum Genetics: EJHG. 2021;29(7):1051–60.

    Article  PubMed  Google Scholar 

  5. Wang X, Chen X, Dobrev D, Li N. The crosstalk between cardiomyocyte calcium and inflammasome signaling pathways in atrial fibrillation. Pflug Arch: Eur J Physiol. 2021;473(3):389–405.

    Article  CAS  Google Scholar 

  6. Joglar JA, Chung MK, Armbruster AL, Benjamin EJ, Chyou JY, Cronin EM, et al. 2023 ACC/AHA/ACCP/HRS Guideline for the diagnosis and management of Atrial Fibrillation: a report of the American College of Cardiology/American Heart Association Joint Committee on Clinical Practice guidelines. Circulation. 2024;149(1):e1–156.

    Article  PubMed  Google Scholar 

  7. Sagris M, Vardas EP, Theofilis P, Antonopoulos AS, Oikonomou E, Tousoulis D. Atrial fibrillation: Pathogenesis, predisposing factors, and Genetics. Int J Mol Sci. 2021;23(1).

  8. Arabia G, Bellicini MG, Cersosimo A, Memo M, Mazzarotto F, Inciardi RM, et al. Ion channel dysfunction and fibrosis in atrial fibrillation: two sides of the same coin. Pacing Clin Electrophysiol. 2024;47(3):417–28.

    Article  PubMed  Google Scholar 

  9. Scott L Jr., Li N, Dobrev D. Role of inflammatory signaling in atrial fibrillation. Int J Cardiol. 2019;287:195–200.

    Article  PubMed  Google Scholar 

  10. Doring Y, Libby P, Soehnlein O. Neutrophil Extracellular traps Participate in Cardiovascular diseases: recent experimental and clinical insights. Circul Res. 2020;126(9):1228–41.

    Article  Google Scholar 

  11. Xiao S, Zhou Y, Liu A, Wu Q, Hu Y, Liu J, et al. Uncovering potential novel biomarkers and immune infiltration characteristics in persistent atrial fibrillation using integrated bioinformatics analysis. Math Biosci Engineering: MBE. 2021;18(4):4696–712.

    Article  Google Scholar 

  12. Friedrichs K, Adam M, Remane L, Mollenhauer M, Rudolph V, Rudolph TK, et al. Induction of atrial fibrillation by neutrophils critically depends on CD11b/CD18 integrins. PLoS ONE. 2014;9(2):e89307.

    Article  PubMed  PubMed Central  Google Scholar 

  13. Pan L, Li Z, Li C, Dong X, Hidru TH, Liu F, et al. Stress hyperglycemia ratio and neutrophil to lymphocyte ratio are reliable predictors of new-onset atrial fibrillation in patients with acute myocardial infarction. Front Cardiovasc Med. 2022;9:1051078.

    Article  PubMed  PubMed Central  Google Scholar 

  14. Giambelluca MS, Bertheau-Mailhot G, Laflamme C, Rollet-Labelle E, Servant MJ, Pouliot M. TNF-α expression in neutrophils and its regulation by glycogen synthase kinase-3: a potentiating role for lithium. Faseb j. 2014;28(8):3679–90.

    Article  CAS  PubMed  Google Scholar 

  15. Li J, Solus J, Chen Q, Rho YH, Milne G, Stein CM, et al. Role of inflammation and oxidative stress in atrial fibrillation. Heart Rhythm. 2010;7(4):438–44.

    Article  PubMed  Google Scholar 

  16. Martins GL, Duarte RCF, Vieira ELM, Rocha NP, Figueiredo EL, Silveira FR et al. Evaluation of new potential inflammatory markers in patients with Nonvalvular Atrial Fibrillation. Int J Mol Sci. 2023;24(4).

  17. Rao F, Xue YM, Wei W, Yang H, Liu FZ, Chen SX, et al. Role of tumour necrosis factor-a in the regulation of T-type calcium channel current in HL-1 cells. Clin Exp Pharmacol Physiol. 2016;43(7):706–11.

    Article  CAS  PubMed  Google Scholar 

  18. Wiersma M, van Marion DMS, Wust RCI, Houtkooper RH, Zhang D, Groot NMS et al. Mitochondrial dysfunction underlies Cardiomyocyte Remodeling in Experimental and Clinical Atrial Fibrillation. Cells. 2019;8(10).

  19. Ohms M, Moller S, Laskay T. An attempt to Polarize Human neutrophils toward N1 and N2 phenotypes in vitro. Front Immunol. 2020;11:532.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Nadezhdin KD, Neuberger A, Trofimov YA, Krylov NA, Sinica V, Kupko N, et al. Structural mechanism of heat-induced opening of a temperature-sensitive TRP channel. Nat Struct Mol Biol. 2021;28(7):564–72.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Lu Y, Zhang Y, Wang N, Pan Z, Gao X, Zhang F, et al. MicroRNA-328 contributes to adverse electrical remodeling in atrial fibrillation. Circulation. 2010;122(23):2378–87.

    Article  CAS  PubMed  Google Scholar 

  22. Rencuzogullari I, Cagdas M, Karakoyun S, Yesin M, Gursoy MO, Artac I, et al. Propensity score matching analysis of the impact of Syntax score and syntax score II on new onset atrial fibrillation development in patients with ST segment elevation myocardial infarction. Ann Noninvasive Electrocardiol. 2018;23(2):e12504.

    Article  PubMed  Google Scholar 

  23. Chang SH, Chan YH, Chen WJ, Chang GJ, Lee JL, Yeh YH. Tachypacing-induced CREB/CD44 signaling contributes to the suppression of L-type calcium channel expression and the development of atrial remodeling. Heart Rhythm. 2021;18(10):1760–71.

    Article  PubMed  Google Scholar 

  24. Karakayali M, Artac I, Omar T, Rencuzogullari I, Karabag Y, Hamideyin S. Assessment of the efficacy of the electrocardiographic P-wave peak time in predicting atrial high rate episode in patients with cardiac implantable electronic devices. J Electrocardiol. 2023;80:40–4.

    Article  PubMed  Google Scholar 

  25. Kaplan AD, Joca HC, Boyman L, Greiser M. Calcium Signaling silencing in Atrial Fibrillation: implications for Atrial Sodium Homeostasis. Int J Mol Sci. 2021;22:19.

    Article  Google Scholar 

  26. Cagalinec M, Zahradnikova A, Zahradnikova A, Kovacova D, Paulis L, Kurekova S et al. Calcium Signaling and Contractility in Cardiac Myocyte of Wolframin deficient rats. Front Physiol. 2019;10.

  27. He L, Liu R, Yue H, Zhang X, Pan X, Sun Y, et al. Interaction between neutrophil extracellular traps and cardiomyocytes contributes to atrial fibrillation progression. Signal Transduct Target Therapy. 2023;8(1):279.

    Article  CAS  Google Scholar 

  28. Sansores-Espana LD, Melgar-Rodriguez S, Vernal R, Carrillo-Avila BA, Martinez-Aguilar VM, Diaz-Zuniga J. Neutrophil N1 and N2 subsets and their possible association with Periodontitis: a scoping review. Int J Mol Sci. 2022;23(20).

  29. Karakayalı M, Omar T, Artaç İ, Rencüzoğulları İ, Karabağ Y, Hamideyin Ş, et al. The White Blood Cell Count to Mean platelet volume ratio (WMR) is Associated with Syntax score in patients with ST-Segment Elevation myocardial infarction. Kafkas J Med Sci. 2023;13(2):173–8.

    Article  Google Scholar 

  30. Zhao L, Li S, Ma X, Bai R, Liu N, Li N, et al. Prognostic significance of left ventricular fibrosis assessed by T1 mapping in patients with Atrial Fibrillation and Heart failure. Sci Rep. 2019;9(1):13374.

    Article  PubMed  PubMed Central  Google Scholar 

  31. Karakayali M, Omar T, Artac I, Ilis D, Arslan A, Altunova M, et al. The prognostic value of HALP score in predicting in-hospital mortality in patients with ST-elevation myocardial infarction undergoing primary percutaneous coronary intervention. Coron Artery Dis. 2023;34(7):483–8.

    Article  PubMed  Google Scholar 

  32. Zhang YL, Zhang RG, Chen FY, Qiu ZE, Chen L, Huang ZX, et al. Cellular mechanism underlying the Facilitation of Contractile Response Induced by Tumor Necrosis factor-alpha in mouse tracheal smooth muscle. Am J Pathol. 2022;192(1):104–11.

    Article  CAS  PubMed  Google Scholar 

  33. Ren M, Li X, Hao L, Zhong J. Role of tumor necrosis factor alpha in the pathogenesis of atrial fibrillation: a novel potential therapeutic target? Ann Med. 2015;47(4):316–24.

    Article  CAS  PubMed  Google Scholar 

  34. Limpitikul WB, Dick IE, Joshi-Mukherjee R, Overgaard MT, George AL Jr., Yue DT. Calmodulin mutations associated with long QT syndrome prevent inactivation of cardiac L-type ca(2+) currents and promote proarrhythmic behavior in ventricular myocytes. J Mol Cell Cardiol. 2014;74:115–24.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. El Khoury N, Mathieu S, Fiset C. Interleukin-1beta reduces L-type Ca2 + current through protein kinase Cϵ activation in mouse heart. J Biol Chem. 2014;289(32):21896–908.

    Article  PubMed  PubMed Central  Google Scholar 

  36. Estes SI, Ye D, Zhou W, Dotzler SM, Tester DJ, Bos JM, et al. Characterization of the CACNA1C-R518C missense mutation in the pathobiology of Long-QT syndrome using Human Induced Pluripotent Stem Cell cardiomyocytes shows Action potential prolongation and L-Type Calcium Channel Perturbation. Circulation Genomic Precision Med. 2019;12(8):e002534.

    Article  CAS  Google Scholar 

  37. Wang J, Ye Q, Bai S, Chen P, Zhao Y, Ma X, et al. Inhibiting microRNA-155 attenuates atrial fibrillation by targeting CACNA1C. J Mol Cell Cardiol. 2021;155:58–65.

    Article  CAS  PubMed  Google Scholar 

Download references

Acknowledgements

The authors are grateful to all participants in the present study.

Funding

This study was supported by Special funded research project of the Fourth Affiliated Hospital of Harbin Medical University [HYDSYTB202216], and Post-doctoral research start-up fund of Heilongjiang Province [LBH-Q19153].

Author information

Author notes

  1. Tao Li, Yan Wang and Jie Wan contributed equally to this work.

Authors and Affiliations

  1. Department of Cardiology, The Fourth Affiliated Hospital of Harbin Medical University, No. 37, Yiyuan Street, Nangang District, Harbin, 150000, Heilongjiang Province, China

    Tao Li, Yan Wang, Jie Wan, Yu Duan, Yang Xu & Mao Yang

Authors
  1. Tao Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Yan Wang
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Jie Wan
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Yu Duan
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Yang Xu
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Mao Yang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors contributed to the study conception and design. Material preparation, data collection was performed by TL, YW, JW and MY. The first draft of the manuscript was written by YW, JW and YD. YX commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Mao Yang.

Ethics declarations

Statement of ethics

This study protocol was reviewed and approved by the Ethics Committee of the Fourth Affiliated Hospital of Harbin Medical University in accordance with regulatory and ethical guidelines.

Informed consent

Informed consent was waived for this retrospective study due to the exclusive use of de-identified patient data, which posed no potential harm or impact on patient care.

Conflict of interest

The authors declare that they have no conflict of interest.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Li, T., Wang, Y., Wan, J. et al. The interaction between neutrophils and atrial myocytes in the occurrence and development of atrial fibrillation. BMC Cardiovasc Disord 24, 519 (2024). https://doi.org/10.1186/s12872-024-04193-3

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12872-024-04193-3

Keywords

BMC Cardiovascular Disorders

ISSN: 1471-2261

Contact us