Skip to main content

Table 1 Forward and reverse primers for RT-qPCR

From: H3K9me2 regulation of BDNF expression via G9a partakes in the progression of heart failure

Gene Sequences (5′-3′)
hsa-G9a-F GGTGAACAACCACCTGGAGGTA
hsa-G9a-R AGGCTGACCATCTCCAAGTTCC
rno-G9a-F GGAGCCAACATCAATGCCGTAG
rno-G9a-R TAGACAGGTGGAGCCATCCTCT
hsa-BDNF-F CATCCGAGGACAAGGTGGCTTG
hsa-BDNF-R GCCGAACTTTCTGGTCCTCATC
rno-BDNF-F GGCTGACACTTTTGAGCACGTC
rno-BDNF-R CTCCAAAGGCACTTGACTGCTG
hsa-GAPDH-F GTCTCCTCTGACTTCAACAGCG
hsa-GAPDH-R ACCACCCTGTTGCTGTAGCCAA
rno-GAPDH-F CATCACTGCCACCCAGAAGACTG
rno-GAPDH-R ATGCCAGTGAGCTTCCCGTTCAG
  1. hsa, homo sapiens; rno, rattus norvegicus; G9a, euchromatic histone lysine methyltransferase; BDNF, brain-derived neurotrophic factor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse