Skip to main content

Table 1 Primer sequences for qPCR

From: Resistance exercise affects catheter-related thrombosis in rats through miR-92a-3p, oxidative stress and the MAPK/NF-κB pathway

Gene Forward primer (5′-3′) Reverse prime (5′-3′) Product size Gene bank accession number
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 50 bp NR_138085.1
miR-92a-3p ATAACGTGAACAGGGCCG CAGTGCGTGTCGTGGAGT 50 bp NR_032335.1
β-actin CGTAAAGACCTCTATGCCAACA TAGGAGCCAGGGCAGTAATC 100 bp NM_031144.3
HO-1 CAGAAGAGGCTAAGACCGCC GGGGCCAACACTGCATTTAC 288 bp NM_012580.2