Skip to main content

Table 1 Primers used in this study

From: The association between estrogen receptor 2 gene polymorphism and complexity of coronary artery disease: an analysis in elective percutaneous coronary intervention patients

Gene Sequence Band size (fragments obtained after digestion)
rs1256049 Forward TTCTGAGCCGAGGTCGTAGT 582 bp
(A: 293 bp + 289 bp; G: 582 bp)
rs1256049 Reverse TGAATCCTTGGACCCAACTC
rs4986938 Forward GTGTGTGGTGGGACACAGAG 646 bp
(A: 445 bp + 201 bp; G: 646 bp)
rs4986938 Reverse AGGCCATTGAGTGTGGAAAC