Skip to main content

Table 1 Primer sequences for RT-qPCR and mature sequences of rat cardiac microRNAs and control U6 snRNA

From: Isolated downregulation of HCN2 in ventricles of rats with streptozotocin-induced diabetic cardiomyopathy

Primer sequences for RT-qPCR
Gene RefSeq accession number Primer sequence (5′–3′) PCR product length (bp)
B2m NM_012512.1 Forward: ATGGAGCTCTGAATCATCTGG
Reverse: AGAAGATGGTGTGCTCATTGC
105
Hcn2 NM_053684.1 Forward: CTGACACCTACTGTCGCCTC
Reverse: TCTTCTTGCCTATGCGGTCC
129
Hcn4 NM_021658.1 Forward: AGTATCCCATGATGCGCAGG
Reverse: TTCTTCTTGCCTATGCGGTCC
70
Hprt1 NM_012583.2 Forward: CAGCTTCCTCCTCAGACCGCTTT
Reverse: TCACTAATCACGACGCTGGGACTG
150
Kcnd2 NM_031730.2 Forward: CCTGGAGAAAACCACGAACC
Reverse: TGCTGGTGACTCCTTGTTGG
131
Kcnh2 NM_053949.1 Forward: GACCTGCTTACTGCCCTCTAC
Reverse: GACGTGCATACAGGTTCAGAG
124
Kcnj11 NM_031358.3 Forward: CACACAGCCACGACAGGATA
Reverse: CGTCTGAACGGGACCATCAA
117
Kcnj2 NM_017296.1 Forward: AACCGCTACAGCATCGTCTC
Reverse: GCACTGTTGTCGGGTATGGA
111
Kcnq1 NM_032073.1 Forward: CTGGTCTGCCTCATCTTCAG
Reverse: TCTGTCCCAAAGAACACCAC
110
Myh6 NM_017239.2 Forward: GCCCTTTGACATCCGCACAGAGT
Reverse: TCTGCTGCATCACCTGGTCCTCC
152
Myh7 NM_017240.1 Forward: GCGGACATTGCCGAGTCCCAG
Reverse: GCTCCAGGTCTCAGGGCTTCACA
133
Ryr2 NM_001191043.1; NM_032078.2 Forward: ACTGCTGGGCTACGGCTAC
Reverse: CTGAAGATGCGGAACCTCTC
99
Sdha NM_130428.1 Forward: GTGTTGCTGTGTCGCTGATC
Reverse: AATGACACCACGGCACTCC
142
Slc2a1 (Glut1) NM_138827.1 Forward: ATTCTCCGTTTCACAGCCCG
Reverse: CTCCTCAATTACCTTCTGGGGG
176
Slc2a4 (Glut4) NM_012751.1 Forward: GACCCGCCCTTTGCACACCA
Reverse: TCACTCGCTGCTGAGGGGGT
174
Tnnt2 NM_012676.1 Forward: GACAGGATCGAAAAGCGTCG
Reverse: AGCCTTCCTCCTGTTCTCCT
132
Tnni3 NM_017144.2 Forward: GAGCTTCAGGACCTATGCCG
Reverse: AACTTGCCACGCAGGTCATA
143
Mature sequences of rat cardiac microRNAs  
microRNA name Nomenclature of mature form Sequence Assay ID
miR-1 rno-miR-1-3p 5′-UGGA AUG UAA AGA AGU GUG UAU-3′ 002064
miR-133a rno-miR-133a-3p 5′-UUUG GUC CCC UUC AAC CAG CUG-3′ 002246
U6 U6 snRNA 5′ GTGCTCGCTTCGGCAGCACATATAC
TAAAATTGGAACGATACAGAGAAGAT
TAGCATGGCCCCTGCGCAAGGATGAC
ACGCAAATTCGTGAAGCGTTCCATATT
TT-3′
001973
  1. Seed microRNAs sequences are underlined, source mirBase.org
  2. B2m: β2-Microglobulin; Hcn2: hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2; Hcn4: hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 4; Hprt1: hypoxanthine phosphoribosyltransferase 1; Kcnd2: potassium voltage-gated channel subfamily D member 2; Kcnh2: potassium voltage-gated channel subfamily H member 2; Kcnj11: potassium inwardly rectifying channel subfamily J member 11; Kcnj2: potassium inwardly rectifying channel subfamily J member 2; Kcnq1: potassium voltage-gated channel subfamily Q member 1; Myh6: myosin heavy chain 6 (α‐myosin heavy chain); Myh7: myosin heavy chain 7 (β‐myosin heavy chain); Ryr2: ryanodine receptor; 2 Sdha: succinate dehydrogenase complex flavoprotein subunit A; Slc2a1: solute carrier family 2 member 1 (alias Glut1); Slc2a4: solute carrier family 2 member 4 (alias Glut4); Tnnt2: troponin T2, cardiac type; Tnni3: troponin I3, cardiac type;