Skip to main content

Table 1 Sequences of primers used for detecting micro (mi)RNAs

From: Circulating level of microRNA-142-5p is a potential biomarker for predicting in-stent restenosis: a case–control study

Target gene miRBase accession Primer sequences
miR-132 MIMAT0000426 UAACAGUCUACAGCCAUGGUCG
miR-142-5p MIMAT0000433 CAUAAAGUAGAAAGCACUACU
miR-15b MIMAT0000417 UAGCAGCACAUCAUGGUUUACA
miR-24-2 MIMAT0004497 UGCCUACUGAGCUGAAACACAG
miR-424 MIMAT0001341 CAGCAGCAAUUCAUGUUUUGAA
U6 snRNA CTCGCTTCGGCAGCACA
AACGCTTCACGAATTTGCGT
  1. *The miScript Universal Primer (Qiagen) was used as a reverse primer for detecting mRNAs