Skip to main content

Table 1 The primer sequences applied in our study

From: Are activated B cells involved in the process of myocardial fibrosis after acute myocardial infarction? An in vivo experiment

Gene Tm (°C) Forward sequence Reverse sequence
TGF-β1 62.5 ATGTCTCAGCCTCTTCTCATTC TGGTGAATGACAGTGCGGTTATGG
TNF-α 58.2 ATGTCTCAGCCTCTTCTCATTC GCTTGTCACTCGAATTTTGAGA
IL-6 60.5 CTCCCAACAGACCTGTCTATAC CCATTGCACAACTCTTTTCTCA
IL-1β 60.5 TCGCAGCAGCACATCAACAAGAG TGCTCATGTCCTCATCCTGGAAGG
BAFF 53.9 AACAAGATGTAGACCTCTCAGC CTGCAGACAGTCTTGAATGATG
β-actin 60.5 CTACCTCATGAAGATCCTGACC CACAGCTTCTCTTTGATGTCAC
COL1A1 54.3 AAAGATGGACTCAACGGTCTC CATCGTGAGCCTTCTCTTGAG
COL3A1 52.4 GAAAGAATGGGGAGACTGGAC TACCAGGTATGCCTTGTAATCC
TIMP-1 54.2 CTCCAGTTTGCAAGGGATAGAT CAAAGACCTGAAAACCTCCAAC
MMP-9 53.9 CAAAGACCTGAAAACCTCCAAC GACTGCTTCTCTCCCATCATC