Skip to main content

Table 1 List of utilized primers for qRT-PCR

From: β1 adrenoceptor antibodies induce myocardial apoptosis via inhibiting PGC-1α-related pathway

GeneForward primerReverse primer
β1ARCGACTGCTGGTGCTCGCGTCGAGCGAAAGGGCAGCGTGATGGC
PGC-1αCGCACAACTCAGCAAGTCCTCCCTTGCTGGCCTCCAAAGTCTC
PGC-1βCAAGAAGCGGCGGGAAAGCTCATGTCACCGGAGAGATTT
VEGFGCAGCGACAAGGCAGACTATTACCGTTGGCACGATTTAAGAG
NRF1CCACGTTGGATGAGTACACGCTGAGCCTGGGTCATTTTGT
ERRαAAGCCCTGATGGACACCTCGAAGCCTGGGATGCTCTTG
GAPDHTGGAGTCTACTGGCGTCTTTGTCATATTTCTCGTGGTTCA