Skip to main content

Table 1 Primer sequences

From: Recombinant Klotho protein enhances cholesterol efflux of THP-1 macrophage-derived foam cells via suppressing Wnt/β-catenin signaling pathway

Gene namesForward sequence (5′-3′)Reverse sequence (5′-3′)
KlothoACCAAGAAGAGGAAATCTACCCAGAGGGAGAATC
SR-A1CAGTGGGCTGGAGGAAAATGAGGGAGCGGTGGAT
CD36ATTTCCACCTTTTGTTGAATAGTTGTCTGGGTTTTC
ACAT1GCTGCTCTGGTTCTCATGGCTTCATTTACTTCCC
ABCA1GAGGTTGCTGCTGTGGAGGCATGGCTTTATTTGG
ABCG1CAAGTCGGTGTGTGTCTGCTTCCGTGAGGTTATT
β-ActinACACTGTGCCCATCTACGTGTCACGCACGATTTCC