Skip to main content

Table 2 Primers used for real-time quantitative reverse transcription-polymerase chain reaction

From: Circular RNA expression profile and its potential regulative role in human abdominal aortic aneurysm

Genes Forward and reverse sequence Product length (bp)
β-actin F:5′ GTGGCCGAGGACTTTGATTG3’
R: 5′ CCTGTAACAACGCATCTCATATT3’
73
hsa_circ_0060063 F:5′ TCTAAGGTGTCAGATGCCTGATAC 3′
R:5′ TTCTCCACACAGCTAGTATACATGC 3’
110
hsa_circ_0070382 F:5’ TTCCCTACAAAGGACTCTCAGCAT 3′
R:5′ ACTTCATTGGAGTAGGTCTGTTTGG 3’
69
hsa_circ_0005360 F:5’ AGCCAGCTCTGCGTGAACCT 3′
R:5′ CGTTGTTGTCCAAGCATTCG 3’
121
hsa_circ_0002168 F:5’ GACCTACTTCTGCATCACCACAGTT 3′
R:5′ TGTCAGCACCCCAGTGTACCA 3’
80
hsa_circ_0028198 F:5’ TCAAGACAAAGAACTCCCAAATGA 3′
R:5′ AAGAGAGAATCTGCATGATACACCA 3’
81
hsa_circ_0027446 F:5’ CTGGAGAAAAACGGCCAAG 3′
R:5′ TGCTGCCTTTGGGTCTTC 3’
93
  1. Abbreviations: hsa, Homo sapiens; bp, base pair; F, forward; R, reverse