Skip to main content

Table 1 Primer Sequences and Annealing Temperatures

From: Prognostic significance of factor XIIIA promoter methylation status in aneurysmal subarachnoid haemorrhage (aSAH)

Gene Sequence (5′-3′) Annealing temperature Product size
APOE M 5′ GTTGGGGTTAGTTGATGTTTATTAC 3′ (FORWARD)
5′ AAAAAAACTAAACTCCTAATTCGAA 3′ (REVERSE)
56 °C 200 bp
APOE UM 5′ GGTTGGGGTTAGTTGATGTTTATTAT 3′ (FORWARD)
5′ AAAAAAACTAAACTCCTAATTCAAA 3′ (REVERSE)
56 °C 200 bp
FXIII M 5′ AGAAGCGAGGGTTTTTGTTC 3′ (FORWARD)
5′ AACAATATAACGCGCTATCG 3′ (REVERSE)
58 °C 100 bp
FXIII UM 5′ TAGAAGTGAGGGTTTTTGTTT 3′ (FORWARD)
5′ AACAATATAACACACTATCAAAA 3′ (REVERSE)
58 °C 100 bp