Skip to main content

Table 1 Primer sequence

From: The expression profile analysis of atrial mRNA in rats with atrial fibrillation: the role of IGF1 in atrial fibrosis

Primer Forward (5′-3′) Reverse (5′-3′)
GAPDH TGCTGAGTATGTCGTGGAGTC GGAGATGATGACCCTTTTGG
MMP19 CTTCGAGTGGCAAAGGGCTA GCACTAGGTCAAGTGCCCAT
COL12A1 GACACCCCCTTCTGACAGTG GAGGTCATGCAAGACTGCCT
CALCRL GCGCATCCTATACGGTGTCA AAGTGTTCAGTGGGGCAGTC
SCN5A CTGACTATAGCCGCAGCGAA AGCTTCCACACAGAGACACG
LRRC30 CTATGTCCCGTGTGCCAAGT TCCCCAAAACCCAAAGGGAC
NAV2 CCGAAGGAGACCCACTGATG GCTACTCTGCTCTGGCTTCAA
IGF1 TTCACATCTCTTCTACCTG TAGCCTGTGGGCTTGTTG
CTGF GCGCCTGTTCTAAGACCTGT GGCTTGGCAATTTTAGGCGT
AT1R TGGCTGGCATTTTGTCTGG CCTTGGGGCAGTCATCTTG
COL1A1 GAAGTCATAGGAGTCGAGGGA CATAGGACATCTGGGAAGCAA
COL3A1 GGTTTCTTCTCACCCTGCTTC ACAGAGGACAGATCCCGAGTC