Skip to main content

Table 1 Sequences of the primers used for real-time RT-PCR

From: Low expression of PRMT5 in peripheral blood may serve as a potential independent risk factor in assessments of the risk of stable CAD and AMI

Genes   Genes Primer Sequence (5′-3′)
PRMT5 Fa TGTAGGGAGAAGGACCGTGA
Rb ATGGCTGAAGGTGAAACAGG
GAPDH Fa ACGGATTTGGTCGTATTGGGCG
Rb CTCCTGGAAGATGGTGATGG
  1. Fa, sequence from sense strands
  2. Rb, sequence from anti-sense strands
\