Skip to main content

Table 1 Single Nucleotide Polymorphism Genotyping based on the PCR-RFLP method

From: Impact of VKORC1, CYP4F2 and NQO1 gene variants on warfarin dose requirement in Han Chinese patients with catheter ablation for atrial fibrillation

SNP Forward (F) and Reverse (R) Primer Sequence (5' → 3') Extended size(bp) Restriction Enzyme Reference
NQO1
rs1800566
F: AAGCCCAGACCAACTTCT
R: GCGTTTCTTCCATCCTTC
196 Hinf I [3, 16]
VKORC1
rs9923231
F: ATCCCTCTGGGAAGTCAAGC
R: CACCTTCAACCTCTCCATCC
636 BcnI [4]
CYP4F2 V433 M rs2108622 F: AGTCCCGGTCATCTCCCGCCAT
R: CGCCAGCCTTGGAGAGACAGACA
358 PvuII [4]
  1. SNP single nucleotide polymorphism. bp base pair