Skip to main content

Table 1 List of the primers used for real time-PCR experiments

From: Relationship of cardiovascular disease risk factors and noncoding RNAs with hypertension: a case-control study

Noncoding RNAs Oligo Name Sequence (5′ to 3′)
GAPDH Forward primer GGACTCATGACCACAGTCCATGCC
Reverse primer TCAGGGATGACCTTGCCCACAG
NR_027032 Forward primer GTCCTCCACTCCACCTCAAA
Reverse primer TGAGTTCCTGATCGTGTCCA
NR_034083 Forward primer GGCTTCTAATCCGCCCTATC
Reverse primer CAATGACCCAAGGCAAATTC
NR_104181 Forward primer CCATTCAGCTTTCACCATGTGC
Reverse primer ACCTTCAGGCGAGTCCAGATT
U6 Forward primer GCTTCGGCAGCACATATACTAA
Reverse primer AACGCTTCACGAATTTGCGT
miR-126 RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGCATT
Forward primer GCGGCGGTCGTACCGTGAGTAA
miR-143 RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAGCTA
Forward primer GCGGCGGTGAGATGAAGCACTG
miR-145 RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGGGAT
Forward primer GCGGCGGGTCCAGTTTTCCCAG
Universal downstream primer Reverse primer ATCCAGTGCAGGGTCCGAGG