Skip to main content

Table 1 Sequences of primers used for real-time RT-PCR analysis

From: Trimetazidine attenuates pressure overload-induced early cardiac energy dysfunction via regulation of neuropeptide Y system in a rat model of abdominal aortic constriction

NPY-1R-F 5′GCTGTGGAACGTCATCAGCTA3′
NPY-1R-R 5′TTGATAGATCACGAAGGGCAG3′
NPY-2R-F 5′CCCGGATCTGGAGTAAGCTAAA3′
NPY-2R-R 5′GTGGAGCACATCGCAATAATGT3′
NPY-5R-F 5′CAATACAGCTGCTGCTCGGA3′
NPY-5R-R 5′AAATCGTCTACGCTGCCTCTG3′
ANF-F 5′GGGGGTAGGATTGACAGGAT3′
ANF-R 5′CTCCAGGAGGGTATTCACCA3′
β-MHC-F 5′CCTCGCAATATCAAGGGAAA3′
β-MHC-R 5′TACAGGTGCATCAGCTCCAG3′
β-actin-F 5′GACAGGATGCAGAAGGAGATTACT3′
β-actin-R 5′TGATCCACATCTGCTGGAAGGT3′
  1. F forward, R reverse