Skip to main content

Table 1 Gene-specific oligonucleotides for sqRT-PCR. Primer sets were designed across exon-exon boundaries to avoid amplification of genomic DNA in the cDNA samples that might contain traces of genomic DNA. ALK1 Primers were also used for qRT-PCR analyses (own assay).

From: ALK1 signalling analysis identifies angiogenesis related genes and reveals disparity between TGF-β and constitutively active receptor induced gene expression

Gene Forward primer (5' – 3' orientation) Reverse primer (5' – 3' orientation) PCR annealing Temp (°C)
TLS TTGAGTCTGTGGCTGATTAC CACTGGTTGCATTCATTCCT 56
GADD153 GTCTAAGGCACTGAGCGTAT TGGGGAATGACCACTCTGTT 58
IL-8 GATTGAGAGTGGACCACACT TCGGATATTCTCTTGGCCCT 58
SMAD6 GTCTTACACTGAAACGGAGG AGCTGATGCGGACGCTGTTG 58
COL5A1 TCGATCCTAACCAAGGATGC TGTGACGCTTCACCGAAGTC 58
HEF1 GAAGAATGGGCCGGAGAGCA GGGAAATGAAATGGGTCTCA 56
TLR4 ACAAAATCCCCGACAACCTC ATGTAGAACCCGCAAGTCTG 58
ET-1 CCTGGACATCATTTGGGTCA AGGGCTTGCCTTTCAGCTTG 58
CARP ACCGCTATAAGATGATCCGA AATGAAGCTCTGCTCACCAG 56
HPTPη GGGCACTTTCATTGCCATTG CATAGCTCCCTTTTCCTGGT 58
DNAJB1 ACTACTACCAGACGTTGGGC CCGCTTGTGGGAGATTTTCG 60
MGSA GGGAATTCACCCCAAGAACA ATCACAGTGGCTGGCATGTT 58
c-myc AGGCTATTCTGCCCATTTGG CCACATACAGTCCTGGATGA 58
ALK1 GCAACCTGCAGTGTTGCATC CGGATCTGCTCGTCCAGCAC 60
GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 60