Skip to main content

Table 1 Primer sequence of TIMP-1, -2, MMP2, MMP9, p38MAPK and GAPDH for real time PCR

From: Effects of reduced β2-glycoprotein I on the expression of aortic matrix metalloproteinases and tissue inhibitor matrix metalloproteinases in diabetic mice

Gene name Primer sequence  
TIMP-1 Forward 5′AGACACACCAGAGCAGATACC3′
  Reverse 5′CAGCTACAGGCCTTACTGGAA3′
TIMP-2 Forward 5′GCTCCAACCCTGTCCTAACC3′
  Reverse 5′GCACAACACGAAAATGCCCT3′
MMP2 Forward 5′TTTCTATGGCTGCCCCAAGG3′
  Reverse 5′GTCAAGGTCACCTGTCTGGG3′
MMP9 Forward 5′CGGATCCCCAACCTTTTCCA3′
  Reverse 5′GTGCCTGTCACAAAAGCCAG3′
p38 MAPK Forward 5′AAGACTCGTTGGAACCCCAG3′
  Reverse 5′GGGTCGTGGTACTGAGCAAA3′
GADPH Forward 5′CAAGGTCATCCATGACAACTTG3′
  Reverse 5′GTCCACCACCCTGTTGCTGTAG3′