Skip to main content

Table 1 Primer sequences used for semi-quantitative RT-PCR

From: Effects of carvedilol treatment on cardiac cAMP response element binding protein expression and phosphorylation in acute coxsackievirus B3-induced myocarditis

mRNA Primers Annealing temperature ( ° C) Cycles Product (bp)
CVB3 F-CGGTACCTTTGTGCGCCTGT 61 30 314
R-CAGGCCGCCAACGCAGCC
IL-6 F- TGCTGGTGACAACCACGGCC 60 33 308
R- GTACTCCAGAAGACCAGAGG
TNF-α F-CCTGTAGCCCACGTCGTAGC 50 31 374
R-TTGACCTCAGCGCTGAGTTG
MCP-1 F-GCCAACTCTCACTGAAGCC 50 30 161
R-GCTGGTGAATGAGTAGCAGC
β-actin F-AGGGAAATCGTGCGTGACAT 55 24 450
  R-CATCTGCTGGAAGGTGGACA    
\